We narrowed to 27,022 results for: c-myc
-
Plasmid#243717PurposeStably expresses a Myc-tagged AKAP1 with a GDDG mutation and gRNA-resistant silent mutationsDepositorInsertAKAP1 (AKAP1 Human)
UseLentiviralTagsMycMutationGXXG motif (GKQG 624-627) mutated to GDDG, and gR…Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMA3228
Plasmid#46856PurposeA lentiviral vector encoding a fusion between codon-optimized P.aeruginosa exoY mutant (K81M) and myc-tagged destabilized FKBP12DepositorInsertExoY K81M
UseLentiviralTagsFKBP E31G, R71G, K105E and MycPromoterTRE-TightAvailable SinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-H2B-EGFP-P2A-N2c(G)
Plasmid#73482PurposeCloning vector containing N2c Glycoprotein and histone GFPDepositorInsertH2B-EGFP-P2A-N2c(G)
ExpressionMammalianAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGWB21_TaNAM-A1
Plasmid#124572PurposeExpresses full-length TaNAM-A1 with an N-terminal 10x Myc tag under the 35s promoter.DepositorInsertTaNAM-A1
Tags10xMycExpressionPlantPromoter35sAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
TK4_SH7_targeting
Plasmid#254454PurposeTK4 targeting vector containing left and right homology arms for the SH7 locusDepositorInsertsmycNLS-mScarlet-T2A-mNeonGreen-PEST
puroR-T2A-mycNLS-mTagBFP2
UsePiggybacTagsPEST, T2A-mycNLS-mTagBFP2, and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable SinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRS316 Gal1p1 IpgA
Plasmid#242952PurposeExpression of IpgA in yeast cellsDepositorInsertIpgA (IcsB Chaperone)
TagsMycExpressionYeastAvailable SinceMarch 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7-GNAI1
Plasmid#248653PurposeYeast 2-hybrid vector encoding human heterotrimeric G protein GNAI1 fused to the GAL4 DNA binding domain.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7-GNAO1
Plasmid#248654PurposeYeast 2-hybrid vector encoding human heterotrimeric G protein GNAO1 fused to the GAL4 DNA binding domain.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7
Plasmid#248655PurposeEmpty vector for generating yeast 2-hybrid GAL4 DNA binding domain fusion constructs by Gateway cloning. It may also be used as an empty vector experimental control.DepositorTypeEmpty backboneUseYeast 2-hybridTagsGAL4 binding domain, MycExpressionYeastAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTKI-Tyr
Plasmid#247647PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKI-Ser
Plasmid#247648PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, from KanR integrating mycobacterial plasmid lacking Ulp1DepositorInsertGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
UseMycobacterial integratingTagsHA tag and Myc tagExpressionBacterialPromoterPTetAvailable SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKIU-Tyr
Plasmid#247649PurposeExpresses GFP-SUMO-Tyr-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmidDepositorInsertsGFP-SUMO-Tyr-mCherry N-degron proteolysis dual-fluorescence reporter
Ulp1 SUMO protease
UseMycobacterial integratingTags3xFLAG tag, HA tag, and Myc tagExpressionBacterialPromoterPTet and PTet (co-operonic with GFP-SUMO-Ser-mChe…Available SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTKIU-Ser
Plasmid#247650PurposeExpresses GFP-SUMO-Ser-mCherry N-degron reporter driven by aTc responsive promoter, and constitutively expresses Ulp1, from KanR integrating mycobacterial plasmidDepositorInsertsGFP-SUMO-Ser-mCherry N-degron proteolysis dual-fluorescence reporter
Ulp1 SUMO protease
UseMycobacterial integratingTags3xFLAG tag, HA tag, and Myc tagExpressionBacterialPromoterPTet and PTet (co-operonic with GFP-SUMO-Ser-mChe…Available SinceDec. 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV5-MLLn-CAGEn-NES (Nrdj1)
Plasmid#241412PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-MLLn-CAGEn-NES (Npu)
Plasmid#241411PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Nrdj1)
Plasmid#241408PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Figure 2 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH1
Plasmid#243679PurposeExpresses Medicago truncatula FAAH1 isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 1
Tagsc-myc, 6xHISExpressionBacterialPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only