We narrowed to 892 results for: KO
-
Plasmid#240295PurposeKI:Sptbn4 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Gria1 Donor;3xV5 KO;Template
Plasmid#240293PurposeKI:Gria1 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Template
Plasmid#240300PurposeKI:Pdha1 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Pdha1
UseAAVMutationNAAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-3-EF1a-LibVec
Plasmid#239599Purposeexpresses guide#3 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-2-EF1a-LibVec
Plasmid#239598Purposeexpresses guide#2 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-1-EF1a-LibVec
Plasmid#239597Purposeexpresses guide#1 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Template
Plasmid#240297PurposeKI:Lmnb1 Donor:3xV5 KO:TemplateDepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
hDNMT3B_KO_puro
Plasmid#234998PurposeStable knockout of DNMT3B function in mammalian cellsDepositorInserthCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
TagsNoneExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-hVASA-KO-WPRE
Plasmid#214124PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInserthKO
ExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
TagsNoneExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RS02060_pMQ30_KO_Kan
Plasmid#185391PurposeNon-replicating vector used to create markerless deletion of RR42_RS02060 in C. basilensis 4G11DepositorInsertsRR42_RS02060 upstream flanking homology region
RR42_RS02060 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS28935_pMQ30_KO_Kan
Plasmid#185392PurposeNon-replicating vector used to create markerless deletion of RR42_RS28935 in C. basilensis 4G11DepositorInsertsRR42_RS28935 upstream flanking homology region
RR42_RS28935 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only