We narrowed to 15,702 results for: grna
-
Plasmid#84254PurposeExpresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pMOD6-pGRR-r11-r10-yeGFP
Plasmid#74368PurposepGRR NOR gate promoter responsive to gRNA-r11 and gRNA-r10. Integrates in the URA locus of W303 and recovers URA function.DepositorArticleInsertyeGFP
UseCRISPR and Synthetic BiologyExpressionYeastPromoterpGRR-r11-r10Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B0_M13ps
Plasmid#231421PurposeM13 phagemid constitutively expressing sgRNA-B0. sgRNA-B0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ552.)DepositorInsertsgRNA-B0
UseSynthetic BiologyAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B1_M13ps
Plasmid#231422PurposeM13 phagemid that expresses sgRNA-B1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ615.)DepositorInsertsgRNA-B1
UseSynthetic BiologyAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C1_M13ps
Plasmid#231411PurposeM13 phagemid that expresses sgRNA-C1 (= sgRNA A5T from Nielsen et al., 2014) from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ272.)DepositorInsertsgRNA-C1
UseSynthetic BiologyAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-2_M13ps
Plasmid#231412PurposeM13 phagemid that expresses sgRNA-2 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ171.)DepositorInsertsgRNA-2
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A0_M13ps
Plasmid#231413PurposeM13 phagemid constitutively expressing sgRNA-A0. sgRNA-A0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI).DepositorInsertsgRNA-A0
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_LacI_pLac-sgRNA-1
Plasmid#231408PurposesgRNA-1 expression from an IPTG-inducible promoter.DepositorInsertssgRNA-1
LacI
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_AraC_pBAD-sgRNA-1
Plasmid#231407PurposesgRNA-1 expression from an arabinose-inducible promoter.DepositorInsertssgRNA-1
AraC
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A1_M13ps
Plasmid#231414PurposeM13 phagemid that expresses sgRNA-A1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ164.)DepositorInsertsgRNA-A1
Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C0_M13ps
Plasmid#231410PurposeM13 phagemid constitutively expressing sgRNA-C0. sgRNA-C0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ156.)DepositorInsertsgRNA-C0
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-1_M13ps
Plasmid#231409PurposeM13 phagemid that expresses sgRNA-1 from a strong constitutive promoter.DepositorInsertsgRNA-1
UseSynthetic BiologyAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
p103DestTol2pA2-4xU6sgRNA
Plasmid#227778PurposeDestination vector with U6 driven 4 sgRNAsDepositorInsert4xU6:sgRNA
UseCRISPRPromoterU6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only