We narrowed to 18,187 results for: jun
-
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-EYFP
Plasmid#137162PurposeIntersectional viral expression of EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-CoV2-Inframe-stop
Plasmid#177620PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. GFP is in-frame with mCherry. Thus GFP translation is prevented by stop codon within FSE (negative control).DepositorInsertSARS-CoV-2 FSE
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5_ALFA-EGFP-NPM1
Plasmid#238261PurposeFor overexpression of ALFA-EGFP-NPM1DepositorInsertALFA-EGFP-NPM1
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-hygro-STING HAQ
Plasmid#102600PurposeExpress STING HAQ for IFN-beta Luciferase reporter assay.DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-GFP-nb-KS
Plasmid#238260PurposeFor overexpression of mCherry-GFP-nb-KSDepositorInsertmCherry-GFP-nb-KS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Tox2-IRES-eGFP
Plasmid#165428PurposeExpresses TOX2 in mammalian cellsDepositorAvailable SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
MYH11-NanoLuc-2A-tdTomato
Plasmid#132569PurposeDonor vector to knockin NanoLuc and tdTomado (separated by 2A) into MYH11 alleleDepositorInsertHuman MYH11 knockin homology arms (MYH11 Human)
ExpressionMammalianAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-SRRM2-repair-template
Plasmid#238247PurposeFor knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NLS-dCas13-NLS-eNAT10
Plasmid#238300PurposeExpresses nuclear version of the programmable RNA acetylation system.DepositorInsertdPspCas13b fused to eNAT10 (NAT10 Human, Prevotella sp. P5-125)
UseCRISPRTagsSV40 BPNLS and SV40 BPNLS (C terminal of dPspCas1…ExpressionMammalianMutationH133A for catalytically inactive mutant, deletion…Available SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pN1-RnKIF5C(1-560,Δ6)-Halo-Flag
Plasmid#188072PurposeMammalian cell expression of truncated version (aa 1-560) of rat kinesin-1 KIF5C tagged with Halo and Flag tags. The delta6 mutation removes the first 6 amino acids.DepositorInsertrat KIF5C (Kif5c Rat)
TagsFlag and HaloExpressionMammalianMutationaa1-560, deletion of aa2-6PromoterCMVAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-SC4
Plasmid#236254PurposeAAV-SC4 capsid which targets peripheral nerves in miceDepositorInsertsrep/cap AAV9 VP1 with GATPSTQ peptide insert
rep
UseAAVExpressionMammalianAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-mtagBFP-2A STING-342STOP
Plasmid#102588PurposeLentivector to express STING delta 342 and mTagBFPDepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF.delmFasL.CMV.GFP
Plasmid#17620DepositorInsertdelFasL (Fasl Mouse)
UseLentiviralExpressionMammalianMutationNoncleavable mouse delFasL . Deleted the exon 2 r…Available SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-mScarletP2A-hLuc
Plasmid#218793PurposeAAV reporter genome plasmidDepositorInsertNLSf-mScarletP2A-hLuc
UseAAVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEVI(408)-ColE-iLight-msfGFP
Plasmid#170268PurposeExpresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.DepositorInsertiLight
TagsmsfGFPExpressionBacterialMutationTo design iLight for expression in bacteria, a fu…PromoterpJ23116Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only