We narrowed to 24,451 results for: ina
-
Plasmid#188856PurposeLarge terminase from phage CBA120DepositorInsertTerminase
ExpressionBacterialAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
INADL_PDZ_5
Plasmid#103905PurposeProtein expression and purification of INADL PDZ5 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
INADL_PDZ_6
Plasmid#103906PurposeProtein expression and purification of INADL PDZ6 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
INADL_PDZ_7
Plasmid#103907PurposeProtein expression and purification of INADL PDZ7 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
INADL_PDZ_2
Plasmid#103902PurposeProtein expression and purification of INADL PDZ2 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
INADL_PDZ_3
Plasmid#103903PurposeProtein expression and purification of INADL PDZ3 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
INADL_PDZ_4
Plasmid#103904PurposeProtein expression and purification of INADL PDZ4 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
ninaC-15
Plasmid#25889DepositorInsertp174
UseStratageneExpressionBacterialAvailable SinceAug. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCW-codon optimized catalytically inactive PHGDH
Plasmid#154903PurposeExpresses codon optimized catalytically inactive PHGDH in mammalian cellsDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseLentiviralExpressionMammalianMutationThree mutations: D175N, R236K, H283APromoterTREAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNP2321 (Cloning backbone, bRNA + recombinase]
Plasmid#247249PurposeCloning backbone for cloning bridge recombinase and bridge RNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-human LIC1 C-terminal half
Plasmid#74599Purposeused for expression in E. coli and purification. N-terminal GST tag and C-terminal Strep tag, aa 389-523DepositorInserthuman dynein light intermediate chain 1 amino acids 389-523 (DYNC1LI1 Human)
TagsN-terminal GST and Strep IIExpressionBacterialMutationamino acids 389-523 of LIC1PromoterT7Available SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
AiP13781 - pAAV-AiE0452h-minBG-iCre(R297T)-BGHpA (Alias: CN3781)
Plasmid#199777Purposeenhancer AAV for Cre recombinase expression in striatal indirect pathway D2-MSNsDepositorHas ServiceAAV PHP.eBInsertiCre(R297T)
UseAAVMutationR297T for reduced recombinase efficiency.Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKT-CNP-inact
Plasmid#211804PurposeExpresses inactive 2',3'-cyclic nucleotide phosphodiesterase catalytic domain (catalytic residues mutated)DepositorInsert2',3'-cyclic nucleotide phosphodiesterase catalytic domain (Cnp Rat)
ExpressionBacterialMutationH73L H153LPromotertetAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
∆C' terminal-DPYSL2-pLJC2
Plasmid#189867PurposeExpresses human DPYSL2 (CRMP2) lacking the C' terminus (491-572 aa), in mammalian cellsDepositorInsertΔC-DPYSL2
UseLentiviralTags3X FLAGExpressionMammalianMutationdeleted the C'terminus of DPYSL2 (491-572 aa)Available SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only