We narrowed to 80 results for: cat
-
-
Transferable Skills Guide: Cross-team Communication
TypeBlog Post -
New Tools Enable CRISPRa for Neuroscience Applications
TypeBlog Post -
Addgene Protocols Go Viral: AAV Purification and Titration
TypeBlog Post -
Communicating Your Science With Help From ComSciCon
TypeBlog Post -
New Educational Resource: The Addgene Videos Page
TypeBlog Post -
Are Hybrid Guide RNAs Right for Your CRISPR Application?
TypeBlog Post -
-
-
-
-
-
-
-
-
-
Sequencing Primers
TypeGuide...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ... -
Educational Resources
TypeGuide -
DNA Quantification
TypeProtocol -
CRISPR Library Amplification
TypeProtocol