Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL4-Cluster Promoter Delta 1.1
(Plasmid #100129)


Item Catalog # Description Quantity Price (USD)
Plasmid 100129 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4322
  • Total vector size (bp) 5136
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    miR-183-96-82 Cluster promoter 0.8 Kb Fragment
  • Alt name
    miR-182 cluster promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Addgene's sequencing results found two discrepancies compared to the depositor's sequence: 123_124insAATT, 162delG, & 854G>T. Some differences could be SNPs and do not occur near the binding sites of the transcription factors of interest; thus they should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4-Cluster Promoter Delta 1.1 was a gift from Eva Hernando (Addgene plasmid # 100129 ; ; RRID:Addgene_100129)
  • For your References section:

    Kruppel-like factor 4 (KLF4) regulates the miR-183~96~182 cluster under physiologic and pathologic conditions. Segura MF, Jubierre L, Li S, Soriano A, Koetz L, Gaziel-Sovran A, Masanas M, Kleffman K, Dankert JF, Walsh MJ, Hernando E. Oncotarget. 2017 Apr 18;8(16):26298-26311. doi: 10.18632/oncotarget.15459. 10.18632/oncotarget.15459 PubMed 28412746