Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #100283)


Item Catalog # Description Quantity Price (USD)
Plasmid 100283 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Junichi Miyazaki (Osaka University, Japan)
  • Backbone size w/o insert (bp) 4870
  • Total vector size (bp) 8551
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Phytochrome interacting factor 3
  • Alt name
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • Mutation
    N-terminus (1-100 aa) of PIF3 is used
  • GenBank ID
  • Entrez Gene
    PIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer agatgctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Expression vector of PIF3-mEGFP in mammalian cells. Of note, the expression level of PIF3-mEGFP must be comparable or lower than that of PhyB. We usually co-transfect pCAGGS-PhyB-mCherry-HRasCT and pCAGGS-PIF3-mEGFP plasmids into HeLa cells with lipofection in a 50:1 ratio.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-PIF3-mEGFP was a gift from Kazuhiro Aoki (Addgene plasmid # 100283 ; ; RRID:Addgene_100283)
  • For your References section:

    Efficient synthesis of phycocyanobilin in mammalian cells for optogenetic control of cell signaling. Uda Y, Goto Y, Oda S, Kohchi T, Matsuda M, Aoki K. Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114. 10.1073/pnas.1707190114 PubMed 29078307