pGEX4T3-Stx3(1-265)
(Plasmid
#100573)
-
PurposeExpresses cytoplasmic domain of Stx3(1-265) with a GST tag on the N-term.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX4T3
-
Backbone manufacturerGE Lifesciences
- Backbone size w/o insert (bp) 4968
- Total vector size (bp) 5838
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStx3-1-265
-
Alt nameStx3 cytoplasmic
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)870
-
MutationNo transmembrane domain, residues 4-264 present.
-
Entrez GeneStx3 (a.k.a. Stx3a)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T3-Stx3(1-265) was a gift from Thomas Weimbs (Addgene plasmid # 100573 ; http://n2t.net/addgene:100573 ; RRID:Addgene_100573)