pDONR207-mTalin
(Plasmid
#100591)
-
PurposeGateway entry vector for mouse Talin (mTalin)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDONR207
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5585
- Total vector size (bp) 4009
-
Vector typeRepoter plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemTalin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)636
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR207-mTalin was a gift from Yutaka Kodama (Addgene plasmid # 100591 ; http://n2t.net/addgene:100591 ; RRID:Addgene_100591) -
For your References section:
Actin-dependence of the chloroplast cold positioning response in the liverwort Marchantia polymorpha L. Kimura S, Kodama Y. PeerJ. 2016 Sep 28;4:e2513. eCollection 2016. 2513 [pii] PubMed 27703856