Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #100898)


Item Catalog # Description Quantity Price (USD)
Plasmid 100898 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8484
  • Total vector size (bp) 8893
  • Modifications to backbone
    Insertion of 2nd U6-gRNA scaffold.
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized CRISPR associated protein 9 Nickase
  • Alt name
  • Alt name
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGGGATGGTTGGTTGGTGGG
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    U6-gRNA scaffold 1
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    U6-gRNA scaffold 2
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer bgh PA F TGCATCGCATTGTCTGAGTAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Modified from pX330-U6-Chimeric_BB-CBh-hSpCas9 (

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDG330 was a gift from Paul Thomas (Addgene plasmid # 100898 ; ; RRID:Addgene_100898)
  • For your References section:

    Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. Adikusuma F, Pfitzner C, Thomas PQ. PLoS One. 2017 Dec 6;12(12):e0187236. doi: 10.1371/journal.pone.0187236. eCollection 2017. PONE-D-17-32080 [pii] PubMed 29211736