Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #101852)


Item Catalog # Description Quantity Price (USD)
Plasmid 101852 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5845
  • Total vector size (bp) 10279
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Ascl1, Brn2
  • Alt name
    ASH1, HASH1, MASH1, bHLHa46; POU3F2, OCT7; OTF7; OTF-7; POUF3, oct-7; N-Oct3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
    429 5454
  • Promoter U6, PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer tttcccatgattccttcata
  • 3′ sequencing primer catagttaagaataccag
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6REST1_U6REST2.hPGK.BRN2.hPGK.Ascl1WPRE was a gift from Malin Parmar (Addgene plasmid # 101852 ; ; RRID:Addgene_101852)
  • For your References section:

    REST suppression mediates neural conversion of adult human fibroblasts via microRNA-dependent and -independent pathways. Drouin-Ouellet J, Lau S, Brattas PL, Rylander Ottosson D, Pircs K, Grassi DA, Collins LM, Vuono R, Andersson Sjoland A, Westergren-Thorsson G, Graff C, Minthon L, Toresson H, Barker RA, Jakobsson J, Parmar M. EMBO Mol Med. 2017 Aug;9(8):1117-1131. doi: 10.15252/emmm.201607471. 10.15252/emmm.201607471 PubMed 28646119