-
PurposeAAV vector to drive TET-ON activator expression from human synapsin I promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 3882
- Total vector size (bp) 4629
-
Modifications to backbonehuman synapsin I promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTAV16
-
Alt nametet-on
-
SpeciesE. coli, herpes simplex virus
-
Insert Size (bp)747
-
MutationrtTA variant reported in Gene Therapy (2006) 13, 1382–1390
- Promoter human synapsin I promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGTATGATGCCTGTCCAGC
- 3′ sequencing primer TTATTAGGACAAGGCTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHuman synapsin I promoter was cloned by Dr. Hiroyuki Hioki.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was also used in two-photon calcium imaging paper. Sadakane et al. Cell Rep. (2015) 13(9):1989-99. PMID: 26655910. The TV16 mutation was introduced to pTET-ON advanced by Drs. Ryosuke Matsui and Dai Watanabe of Kyoto university. The details of the mutation was originally reported in Gene Therapy (2006) 13, 1382–1390. The human synapsin I promoter was cloned by Dr. Hiroyuki Hioki in Kyoto university.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hSynI-rtTAV16 was a gift from Tetsuo Yamamori (Addgene plasmid # 102367 ; http://n2t.net/addgene:102367 ; RRID:Addgene_102367) -
For your References section:
Simultaneous visualization of extrinsic and intrinsic axon collaterals in Golgi-like detail for mouse corticothalamic and corticocortical cells: a double viral infection method. Watakabe A, Takaji M, Kato S, Kobayashi K, Mizukami H, Ozawa K, Ohsawa S, Matsui R, Watanabe D, Yamamori T. Front Neural Circuits. 2014 Sep 17;8:110. doi: 10.3389/fncir.2014.00110. eCollection 2014. 10.3389/fncir.2014.00110 PubMed 25278843