AAV-hSynI-rtTAV16
(Plasmid #102367)

• Purpose: AAV vector to drive TET-ON activator expression from human synapsin I promoter
• Depositing Lab: Tetsuo Yamamori
• Publication: Watakabe et al Front Neural Circuits. 2014 Sep 17;8:110. doi: 10.3389/fncir.2014.00110. eCollection 2014.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 3882
• Total vector size (bp): 4629
• Modifications to backbone: human synapsin I promoter
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rtTAV16
• Alt name: tet-on
• Species: E. coli, herpes simplex virus
• Insert Size (bp): 747
• Mutation: rtTA variant reported in Gene Therapy (2006) 13, 1382–1390
• Promoter: human synapsin I promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGGTATGATGCCTGTCCAGC
• 3′ sequencing primer: TTATTAGGACAAGGCTGGTG

Resource Information

• Supplemental Documents:
  • pAAV-hSYN1P-rtTAV16.gb
• A portion of this plasmid was derived from a plasmid made by: Human synapsin I promoter was cloned by Dr. Hiroyuki Hioki.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was also used in two-photon calcium imaging paper. Sadakane et al. Cell Rep. (2015) 13(9):1989-99. PMID: 26655910. The TV16 mutation was introduced to pTET-ON advanced by Drs. Ryosuke Matsui and Dai Watanabe of Kyoto university. The details of the mutation was originally reported in Gene Therapy (2006) 13, 1382–1390. The human synapsin I promoter was cloned by Dr. Hiroyuki Hioki in Kyoto university.