Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAVTREGCaMP6f
(Plasmid #97410)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 97410 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4477
  • Total vector size (bp) 5830
  • Modifications to backbone
    TRE3 promoter, WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Species
    R. norvegicus (rat), G. gallus (chicken); Aequorea coerulescens
  • Insert Size (bp)
    1353
  • Promoter TRE3

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGAACTTGTGGCCGTTTAC
  • 3′ sequencing primer ccttgtataaatcctggttgctg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVTREGCaMP6f was a gift from Tetsuo Yamamori (Addgene plasmid # 97410 ; http://n2t.net/addgene:97410 ; RRID:Addgene_97410)
  • For your References section:

    Long-Term Two-Photon Calcium Imaging of Neuronal Populations with Subcellular Resolution in Adult Non-human Primates. Sadakane O, Masamizu Y, Watakabe A, Terada S, Ohtsuka M, Takaji M, Mizukami H, Ozawa K, Kawasaki H, Matsuzaki M, Yamamori T. Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19. 10.1016/j.celrep.2015.10.050 PubMed 26655910