Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-TRE-GCaMP6s
(Plasmid #135418)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135418 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAVTREGCaMP6f
  • Backbone manufacturer
    Tetsuo Yamamori
  • Backbone size w/o insert (bp) 5830
  • Total vector size (bp) 5765
  • Modifications to backbone
    A fragment containing GCaMP6s was swapped into replace GCaMP6f in the original backbone.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Alt name
    GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Alt name
    GCaMP3 variant 641
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • Insert Size (bp)
    1274
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NHEI (not destroyed)
  • 5′ sequencing primer TAGCGCCACCATGGTCGACTCA
  • 3′ sequencing primer GGATCCTTACTACTTCGCT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6s was synthesized de novo based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TRE-GCaMP6s was a gift from Rylan Larsen (Addgene plasmid # 135418 ; http://n2t.net/addgene:135418 ; RRID:Addgene_135418)