Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #97411)


Item Catalog # Description Quantity Price (USD)
Plasmid 97411 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6329
  • Total vector size (bp) 7076
  • Modifications to backbone
    mouse thy1PSs promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    tTA2, tet-advanced
  • Species
    E. coli, herpes simplex virus
  • Insert Size (bp)
  • Promoter mouse thy1PSs

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGTATGATGCCTGTCCAGC
  • 3′ sequencing primer TTATTAGGACAAGGCTGGTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

The thy1S promoter used in this vector was originally provided by Dr. Kawaski in Kanazawa university. The reference for the original work is "Ako et al (2011) Simultaneous visualization of multiple neuronal properties with single-cell resolution in the living rodent brain. Mol Cell Neurosci 48:246–257." We shortened their sequence to accommodate in the AAV vector. It was originally used to sparsely label the marmoset neurons (ref: Sadakane et al. In Vivo Two-Photon Imaging of Dendritic Spines in Marmoset Neocortex(1,2,3). eNeuro. 2015 Sep17;2(4).). For two-photon calcium imaging, we used the vector at high concentration, at which condition, there seems to be low cell type specificity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_Thy1StTA was a gift from Tetsuo Yamamori (Addgene plasmid # 97411 ; ; RRID:Addgene_97411)
  • For your References section:

    Long-Term Two-Photon Calcium Imaging of Neuronal Populations with Subcellular Resolution in Adult Non-human Primates. Sadakane O, Masamizu Y, Watakabe A, Terada S, Ohtsuka M, Takaji M, Mizukami H, Ozawa K, Kawasaki H, Matsuzaki M, Yamamori T. Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19. 10.1016/j.celrep.2015.10.050 PubMed 26655910