pAAV_Thy1StTA
(Plasmid #97411)

• Purpose: TET driver for amplified expression in cortical neurons
• Depositing Lab: Tetsuo Yamamori
• Publication: Sadakane et al Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 6329
• Total vector size (bp): 7076
• Modifications to backbone: mouse thy1PSs promoter
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tTA
• Alt name: tTA2, tet-advanced
• Species: E. coli, herpes simplex virus
• Insert Size (bp): 747
• Promoter: mouse thy1PSs

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGGTATGATGCCTGTCCAGC
• 3′ sequencing primer: TTATTAGGACAAGGCTGGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The thy1S promoter used in this vector was originally provided by Dr. Kawaski in Kanazawa university. The reference for the original work is "Ako et al (2011) Simultaneous visualization of multiple neuronal properties with single-cell resolution in the living rodent brain. Mol Cell Neurosci 48:246–257." We shortened their sequence to accommodate in the AAV vector. It was originally used to sparsely label the marmoset neurons (ref: Sadakane et al. In Vivo Two-Photon Imaging of Dendritic Spines in Marmoset Neocortex(1,2,3). eNeuro. 2015 Sep17;2(4).). For two-photon calcium imaging, we used the vector at high concentration, at which condition, there seems to be low cell type specificity.