Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPB-CAG-rtTA-IRES-Hygro
(Plasmid #102423)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102423 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPBCAG-rtTAM2-IN
  • Backbone manufacturer
    Austin Smith lab
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tetracyclin-transactivator (rtTA)
  • Promoter CAG

Cloning Information

Resource Information

Depositor Comments

IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers:

Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC
Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-CAG-rtTA-IRES-Hygro was a gift from Kian Peng Koh (Addgene plasmid # 102423 ; http://n2t.net/addgene:102423 ; RRID:Addgene_102423)
  • For your References section:

    Lineage-specific functions of TET1 in the postimplantation mouse embryo. Khoueiry R, Sohni A, Thienpont B, Luo X, Velde JV, Bartoccetti M, Boeckx B, Zwijsen A, Rao A, Lambrechts D, Koh KP. Nat Genet. 2017 Jul;49(7):1061-1072. doi: 10.1038/ng.3868. Epub 2017 May 15. 10.1038/ng.3868 PubMed 28504700