Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCH1/RAD51o
(Plasmid #102562)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102562 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCOLADuet-1
  • Backbone manufacturer
    Novagen.EMD Millipore
  • Backbone size w/o insert (bp) 3719
  • Total vector size (bp) 6645
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    we use the plasmid to express RAD51 in E.coli Acella cells (Edge Bio) which have a RecA deletion that is required for purification.
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Homo sapiens RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) (RAD51), transcript variant 1
  • Alt name
    RAD51
  • Alt name
    DNA repair protein RAD51 homolog 1
  • Alt name
    RAD51A
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1020
  • Mutation
    Codon optimized for E.coli Expression
  • GenBank ID
    NM_002875.4
  • Entrez Gene
    RAD51 (a.k.a. BRCC5, FANCR, HRAD51, HsRad51, HsT16930, MRMV2, RAD51A, RECA)
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCAGAGCCGCTCAGACCATAGC
  • 3′ sequencing primer TCGCACCGGCAAAACGCAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    E. coli groE operon
  • Alt name
    GroE
  • Alt name
    GroEL
  • Alt name
    GroES
  • Species
    E. Coli
  • Insert Size (bp)
    1986
  • GenBank ID
    X07850
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer cgtattgtacacggccgcataatcg
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid was specifically designed to allow high levels of RAD51 expression in E.coli along with the ability to incorporate non-natural amino acids using amber suppressor technology. It was used to incorporate an artificial amino acid to mimic tyrosine phosphorylation (published in Subramanyam S, et. al. (2016). Proceedings of the National Academy of Sciences 113(41):E6045-E6054).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCH1/RAD51o was a gift from Maria Spies (Addgene plasmid # 102562 ; http://n2t.net/addgene:102562 ; RRID:Addgene_102562)
  • For your References section:

    Tyrosine phosphorylation stimulates activity of human RAD51 recombinase through altered nucleoprotein filament dynamics. Subramanyam S, Ismail M, Bhattacharya I, Spies M. Proc Natl Acad Sci U S A. 2016 Oct 11;113(41):E6045-E6054. Epub 2016 Sep 26. 10.1073/pnas.1604807113 PubMed 27671650