Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQE30-hPolB
(Plasmid #70761)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70761 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-30
  • Backbone manufacturer
    Qiagen
  • Backbone size w/o insert (bp) 3461
  • Total vector size (bp) 4444
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    POLB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1010
  • Mutation
    R333L
  • GenBank ID
    NM_002690
  • Entrez Gene
    POLB
  • Promoter T5/lac operon
  • Tag / Fusion Protein
    • 6x His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer GTTCTGAGGTCATTACTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA was received from Samuel H. Wilson's lab (Beard et al., 1996, J. Biol. Chem. 271, 12141–12144 )
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE30-hPolB was a gift from Primo Schaer (Addgene plasmid # 70761 ; http://n2t.net/addgene:70761 ; RRID:Addgene_70761)
  • For your References section:

    3CAPS - a structural AP-site analogue as a tool to investigate DNA base excision repair. Schuermann D, Scheidegger SP, Weber AR, Bjoras M, Leumann CJ, Schar P. Nucleic Acids Res. 2016 Jan 4. pii: gkv1520. 10.1093/nar/gkv1520 PubMed 26733580