pAAV-CamKIIa-C1V1::FusionRed::Kv2.1
(Plasmid
#102771)
-
Purpose"Activate neurons with 2p stimulation"
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 102771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5366
- Total vector size (bp) 7334
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC1V1::FusionRed::Kv2.1
-
Insert Size (bp)1968
-
Tags
/ Fusion Proteins
- FusionRed (C terminal on insert)
- Kv2.1 traficking domain (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCGTCATTTACAGTTCAAATGGT
- 3′ sequencing primer CACGTTGTAAACGCCTGGTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CamKIIa-C1V1::FusionRed::Kv2.1 was a gift from Karel Svoboda (Addgene plasmid # 102771 ; http://n2t.net/addgene:102771 ; RRID:Addgene_102771)