-
PurposeExpresses improved CRY2PHR homo-oligomerization
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmCherry-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4658
- Total vector size (bp) 6179
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry-CRY2PHR-9aa
-
Alt namemCherry-CRY2clust
-
Alt name839529
-
SpeciesH. sapiens (human), A. thaliana (mustard weed)
-
Insert Size (bp)1521
-
Entrez GeneCRY2 (a.k.a. AT1G04400, AT-PHH1, ATCRY2, CRYPTOCHROME 2 APOPROTEIN, F19P19.14, F19P19_14, FHA, PHH1, cryptochrome 2)
- Promoter CMV
-
Tag
/ Fusion Protein
- 9 amino acids (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site MfeI (not destroyed)
- 5′ sequencing primer ATGAAGATGGACAAAAAGACCATCGTCTGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-CRY2clust was a gift from Won Do Heo (Addgene plasmid # 105624 ; http://n2t.net/addgene:105624 ; RRID:Addgene_105624) -
For your References section:
Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2. Park H, Kim NY, Lee S, Kim N, Kim J, Heo WD. Nat Commun. 2017 Jun 23;8(1):30. doi: 10.1038/s41467-017-00060-2. 10.1038/s41467-017-00060-2 PubMed 28646204