pAAV-synp-F-H2B-GCaMP6f
(Plasmid
#102994)
-
PurposeExpresses histone fused GCaMP6f under the synapsin promoter
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerunknown
- Total vector size (bp) 6502
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsAlthough Stable strains are highly recommended, regular strains (eg, DH5alpha) can be used for better yield.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-GCaMP6f
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1662
- Promoter human synapsin I promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer GTCGACTCCGGAATAACTTCGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-synp-F-H2B-GCaMP6f was a gift from David Cox (Addgene plasmid # 102994 ; http://n2t.net/addgene:102994 ; RRID:Addgene_102994) -
For your References section:
High-speed volumetric imaging of neuronal activity in freely moving rodents. Skocek O, Nobauer T, Weilguny L, Martinez Traub F, Xia CN, Molodtsov MI, Grama A, Yamagata M, Aharoni D, Cox DD, Golshani P, Vaziri A. Nat Methods. 2018 Jun;15(6):429-432. doi: 10.1038/s41592-018-0008-0. Epub 2018 May 7. 10.1038/s41592-018-0008-0 PubMed 29736000