Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SLC39A14-GFP
(Plasmid #104380)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104380 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC39A14
  • Alt name
    ZIP14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Entrez Gene
    SLC39A14 (a.k.a. HMNDYT2, LZT-Hs4, NET34, ZIP14, cig19)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GTC GGT ACC ATG AAG CTG CTG CTG CTG CAC
  • 3′ sequencing primer CGCGGATCCCCCAATCTGGATCTGTCCTGAATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SLC39A14-GFP was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 104380 ; http://n2t.net/addgene:104380 ; RRID:Addgene_104380)
  • For your References section:

    Hypothyroidism induced by loss of the manganese efflux transporter SLC30A10 may be explained by reduced thyroxine production. Liu C, Hutchens S, Jursa T, Shawlot W, Polishchuk EV, Polishchuk RS, Dray BK, Gore AC, Aschner M, Smith DR, Mukhopadhyay S. J Biol Chem. 2017 Oct 6;292(40):16605-16615. doi: 10.1074/jbc.M117.804989. Epub 2017 Aug 31. 10.1074/jbc.M117.804989 PubMed 28860195