Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #104589)


Item Catalog # Description Quantity Price (USD)
Plasmid 104589 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2905
  • Total vector size (bp) 5836
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    calcium/calmodulin-dependent protein kinase II alpha
  • Alt name
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Camk2a (a.k.a. CaMKII, R74975, mKIAA0968)
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-HDR-mEGFP-camk2a was a gift from Ryohei Yasuda (Addgene plasmid # 104589 ; ; RRID:Addgene_104589)
  • For your References section:

    Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Nishiyama J, Mikuni T, Yasuda R. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. 10.1016/j.neuron.2017.10.004 PubMed 29056297