-
PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta Actin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 119870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePX551
- Backbone size w/o insert (bp) 2905
- Total vector size (bp) 5992
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebeta Actin
-
Alt namebActin
-
SpeciesM. musculus (mouse)
-
Entrez GeneActb (a.k.a. Act, Actx, E430023M04Rik, beta-a, beta-actin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCA (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-HDR-mEGFP-Actin was a gift from Ryohei Yasuda (Addgene plasmid # 119870 ; http://n2t.net/addgene:119870 ; RRID:Addgene_119870) -
For your References section:
Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Nishiyama J, Mikuni T, Yasuda R. Neuron. 2017 Oct 18. pii: S0896-6273(17)30933-9. doi: 10.1016/j.neuron.2017.10.004. 10.1016/j.neuron.2017.10.004 PubMed 29056297