CMV-Y-GECO2m
(Plasmid
#105070)
-
PurposeA yellow fluorescent Ca2+ indicator variant with medium binding affinity and kinetics for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 105070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 3302
- Total vector size (bp) 4565
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameY-GECO2m
-
SpeciesSynthetic
-
Insert Size (bp)1263
-
GenBank IDMG450564
- Promoter CMV
-
Tag
/ Fusion Protein
- 6x His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
This gene is a variant of CMV-Y-GECO1 (Plasmid #55766)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-Y-GECO2m was a gift from Robert Campbell (Addgene plasmid # 105070 ; http://n2t.net/addgene:105070 ; RRID:Addgene_105070) -
For your References section:
Inverse-response Ca(2+) indicators for optogenetic visualization of neuronal inhibition. Zhao Y, Bushey D, Zhao Y, Schreiter ER, Harrison DJ, Wong AM, Campbell RE. Sci Rep. 2018 Aug 6;8(1):11758. doi: 10.1038/s41598-018-30080-x. 10.1038/s41598-018-30080-x PubMed 30082904