Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #105516)


Item Catalog # Description Quantity Price (USD)
Plasmid 105516 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4694
  • Total vector size (bp) 6083
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Trim21 (a.k.a. Ro52, Ssa1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The sequence contains an E318K in mTrim21. This mutation does not affect plasmid function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-C1-mTrim21 was a gift from Melina Schuh (Addgene plasmid # 105516 ; ; RRID:Addgene_105516)
  • For your References section:

    A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837