Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEMHE-membrane-mEGFP
(Plasmid #105526)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105526 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEMHE
  • Backbone size w/o insert (bp) 3112
  • Total vector size (bp) 3889
  • Vector type
    in vitro Transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GNAI2
  • Alt name
    GIPB
  • Alt name
    H_LUCA15.1
  • Alt name
    H_LUCA16.1
  • Species
    H. sapiens (human)
  • Mutation
    fragment encoding the plasma membrane targeting sequence (’Membrane’) from Human GNAI2 consisting of the N-terminal amino acids 1-15 (nt 1-45) (which includes N-myristol and S-palmitoyl motifs for targeting and retention at plasma mebrane) in frame with mEGFP
  • GenBank ID
    NC_000003.12
  • Entrez Gene
    GNAI2 (a.k.a. GIP, GNAI2B, H_LUCA15.1, H_LUCA16.1)
  • Promoter T7
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AAGGCGATTAAGTTGGGTAACG
  • 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE-membrane-mEGFP was a gift from Melina Schuh (Addgene plasmid # 105526 ; http://n2t.net/addgene:105526 ; RRID:Addgene_105526)
  • For your References section:

    A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837