Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Tol2-BetaActin-SecA5-YFP
(Plasmid #105664)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105664 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Tol2-pDest
  • Backbone manufacturer
    Gateway
  • Backbone size w/o insert (bp) 11600
  • Total vector size (bp) 13378
  • Modifications to backbone
    Beta-Actin 5' Promoter, PolyA 3'
  • Vector type
    Tol2-Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Secreted Annexin5-EYFP
  • Alt name
    ANXA5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1784
  • Entrez Gene
    ANXA5 (a.k.a. ANX5, ENX2, HEL-S-7, PP4, RPRGL3)
  • Promoter Beta-Actin
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TATAGGGCGAATTGGGTACCGCCACCATGCATAAGGTTT
  • 3′ sequencing primer ACCGCGGTGGCGGCCGCTTACTTGTACAGCTCGTCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-BetaActin-SecA5-YFP was a gift from Qing Deng (Addgene plasmid # 105664 ; http://n2t.net/addgene:105664 ; RRID:Addgene_105664)
  • For your References section:

    Development and Characterization of an Endotoxemia Model in Zebra Fish. Hsu AY, Gurol T, Sobreira TJP, Zhang S, Moore N, Cai C, Zhang ZY, Deng Q. Front Immunol. 2018 Mar 29;9:607. doi: 10.3389/fimmu.2018.00607. eCollection 2018. 10.3389/fimmu.2018.00607 PubMed 29651289