Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pIRE4-Azi
(Plasmid #105829)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105829 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Humanized EAziRS
  • Species
    Synthetic
  • Mutation
    (Y37L, D182S, F183M, L186A, D265R)TyrRS
  • Promoter PGK

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer mPGK-F 5' cattctgcacgcttcaaaag 3'
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    4 copies of the U6-BstYam tRNA cassette
  • Species
    Synthetic
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer Unknown
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The humanized EAziRS gene was synthesized by Invitrogen GeneArt Gene Synthesis (Germany)/ThermoFisher Scientific (Waltham, MA).
  • Terms and Licenses

Depositor Comments

The plasmid has been developed for efficient incorporation of Azi into GPCRs, first used in Seidel et al. eLIFE 2017. With respect to similar plasmids from other labs, this plasmid contains a humanized gene for EAziRS and 4 copies of the U6-BstYam tRNA cassette right downstream of the synthetase cassette.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRE4-Azi was a gift from Irene Coin (Addgene plasmid # 105829 ; http://n2t.net/addgene:105829 ; RRID:Addgene_105829)
  • For your References section:

    Structural insight into the activation of a class B G-protein-coupled receptor by peptide hormones in live human cells. Seidel L, Zarzycka B, Zaidi SA, Katritch V, Coin I. Elife. 2017 Aug 3;6. doi: 10.7554/eLife.27711. 10.7554/eLife.27711 PubMed 28771403