pMXS-IRES-Blast SHMT2res
(Plasmid
#106301)
-
PurposeExpresses SHMT2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106301 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXS-IRES-blast
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7000
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameserine hydroxymethyltransferase 2
-
Alt nameSHMT2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1518
-
MutationSilent mutations destroy sgRNA targeting sites
-
GenBank IDNM_005412 NM_005412
-
Entrez GeneSHMT2 (a.k.a. GLYA, HEL-S-51e, NEDCASB, SHMT, mSHMT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-Blast SHMT2res was a gift from Richard Possemato (Addgene plasmid # 106301 ; http://n2t.net/addgene:106301 ; RRID:Addgene_106301) -
For your References section:
Serine Catabolism by SHMT2 Is Required for Proper Mitochondrial Translation Initiation and Maintenance of Formylmethionyl-tRNAs. Minton DR, Nam M, McLaughlin DJ, Shin J, Bayraktar EC, Alvarez SW, Sviderskiy VO, Papagiannakopoulos T, Sabatini DM, Birsoy K, Possemato R. Mol Cell. 2018 Feb 15;69(4):610-621.e5. doi: 10.1016/j.molcel.2018.01.024. 10.1016/j.molcel.2018.01.024 PubMed 29452640