pCW57.1 N-term GFP tTA
(Plasmid #107551)

• Purpose: (Empty Backbone) All-in-one dox-repressible expression of cDNA with optional N-term GFP tag.
• Depositing Lab: David Sabatini
• Publication: pCW57.1 N-term GFP tTA (unpublished)

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: David Root
• Backbone size (bp): 8234
• Modifications to backbone: tTA replacing rtTA for dox-repression, Blast selection marker replacing puro selection, and GFP inserted as an optional N-terminal tag.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin
• Tag / Fusion Protein:
  • GFP (optional) (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: XL10 gold can be used for propagation and may perform better for large scale culture for maxi prep.
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: AGCAGAGCTCGTTTAGTGAACC
• 3′ sequencing primer: CGAACGGACGTGAAGAATGTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GFP can be used as an N-terminal tag, but the GFP can also be eliminated and used as a 'dropout' for cloning into the vector. NheI can be used to drop the GFP, and SalI can be used to keep GFP as an N-terminal tag. Its quite useful to have GFP as a tag as it can be used for localization, immunoprecipitation, and for Western Blotting.