This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #41393)


Item Catalog # Description Quantity Price (USD)
Plasmid 41393 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 9354
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway Destination vector, Doxycycline inducible
  • Promoter TRE promoter, Tet ON
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Note that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
  • Copy number

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The plasmid expresses rtTA-VP16-2A-puro from the PGK promoter, so it can be used as an 'all-in-one' dox on system.

Alternate plasid names:
TRE-gateway; PGK-rtTA-2A-puro

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1 was a gift from David Root (Addgene plasmid # 41393 ; ; RRID:Addgene_41393)