Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Tet-pLKO-puro
(Plasmid #21915)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone size (bp) 10633
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    recommend rec-deficient E.coli (Stbl3, SURE) at 37C
  • Copy number
    Low Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid was called pLKO-Tet-On in the original publication.  The name was changed to clarify that this plasmid does not contain and is not related to the trademarked Tet-On(R) system sold by Clontech.  No other changes were made.  Clontech does not support or recommend this product.  

Please look at the manual associated with this plasmid.

For additional information please review the following reference -
Wee, S., Wiederschain, D., Maira, S.-M., Loo, A., Miller, C., deBeaumont, R., Stegmeier, F., Yao, Y.-M., and Lengauer, C. PTEN-deficient cancers depend on PIK3CB, Proc Natl Acad Sci U S A. 105: 13057-62, 2008.

Please cite the original publication when describing the use of this plasmid in a subsequent publication: Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tet-pLKO-puro was a gift from Dmitri Wiederschain (Addgene plasmid # 21915)
  • For your References section:

    Single-vector inducible lentiviral RNAi system for oncology target validation. Wiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, Chen Y, Caponigro G, Yao YM, Lengauer C, Sellers WR, Benson JD. Cell Cycle. 2009 Feb 1. 8(3):498-504. 10.4161/cc.8.3.7701 PubMed 19177017