1
Plasmid 21916: Tet-pLKO-neo
  • None

  • Tet-pLKO-neo
    (Search Vector Database)

  • Lentiviral

  • 10633

  • AgeI

  • No

  • EcoRI

  • No

  • GGCAGGGATATTCACCATTATCGTTTCAGA List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • recommend rec-deficient E.coli (Stbl3, SURE) at 37C

  • Low Copy

  • Neomycin

  • View sequences (1)
  • Tet-pLKO Manual (application/pdf)

  • Dmitri Wiederschain

  • MTA

Comments: 

This plasmid was called pLKO-Tet-On-neo in the original publication.  The name was changed to clarify that this plasmid does not contain and is not related to the trademarked Tet-On(R) system sold by Clontech.  No other changes were made.  Clontech does not support or recommend this product.  

Please look at the manual associated with this plasmid.

For additional information please review the following reference -
Wee, S., Wiederschain, D., Maira, S.-M., Loo, A., Miller, C., deBeaumont, R., Stegmeier, F., Yao, Y.-M., and Lengauer, C. PTEN-deficient cancers depend on PIK3CB, Proc Natl Acad Sci U S A. 105: 13057-62, 2008.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Single-vector inducible lentiviral RNAi system for oncology target validation. Wiederschain et al (Cell Cycle. 2009 Feb 1. 8(3):498-504. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21916" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only