Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCre-SacB-zeo
(Plasmid #107706)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107706 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCre-SacB-kan
  • Backbone manufacturer
    Adrie J.C. Steyn
  • Backbone size w/o insert (bp) 8248
  • Total vector size (bp) 8623
  • Modifications to backbone
    Used E. coli recombineering to replace the kanamycin-resistant cassette with a zeocin-resistance cassette.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin(Zeocin)
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ble (Zeo resistance)
  • Insert Size (bp)
    375

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCGCAGACCGATACCAGGATCTTG
  • 3′ sequencing primer CGGGGTGCACTCATCATAGTGCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Eric Rubin, Harvard School of Public Health
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCre-SacB-zeo was a gift from Kenan Murphy (Addgene plasmid # 107706 ; http://n2t.net/addgene:107706 ; RRID:Addgene_107706)
  • For your References section:

    Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316