AAV pCAG-mRuby3-WPRE
(Plasmid
#107744)
-
PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 107744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV pCAG-FLEX-tdTomato-WPRE (#51503)
-
Backbone manufacturerHongkui Zeng/Allen Institute For Brain Science
- Backbone size w/o insert (bp) 5396
- Total vector size (bp) 6270
-
Modifications to backboneA fragment containing mRuby3 was swapped into replace tdTomato and the LoxP sites in the original backbone.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRuby3
-
Alt namemonomeric ruby3
-
Alt namemRuby3 red fluorescent protein
-
Insert Size (bp)874
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer CCAGAGGTTGATTATCGATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV pCAG-mRuby3-WPRE was a gift from Rylan Larsen (Addgene plasmid # 107744 ; http://n2t.net/addgene:107744 ; RRID:Addgene_107744)