p15aC-1D
(Plasmid #107863)

• Purpose: Bacterial expression of PIS
• Depositing Lab: Sanford Simon
• Publication: Botero et al Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar.

Backbone

• Vector backbone: p15aC
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PIS
• Alt name: PI synthase
• Alt name: phosphatidyl inositol synthase
• Alt name: phosphatidylinositol synthase
• Species: Trypanosome brucei
• Promoter: proD
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TATTTCTAGATTTCAGTGCA
• 3′ sequencing primer: TTACAACAGTACTGCGATGA

Resource Information

• Supplemental Documents:
  • p15aC-1D.gbk
• A portion of this plasmid was derived from a plasmid made by: Trypanosome brucei phosphatidyl inositol synthase (PIS)(30) was kindly provided by Dr. Terry K. Smith of The University of St Andrews, UK. See references in paper

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry