p15aC-4D1D-5
(Plasmid #107866)

• Purpose: Bacterial expression of PIS, PI4K and PI4P5K
• Depositing Lab: Sanford Simon
• Publication: Botero et al Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar.

Backbone

• Vector backbone: p15aC
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: PIS
• Alt name: phosphatidyl inositol synthase
• Alt name: phosphatidylinositol synthase
• Alt name: PI synthase
• Species: Trypanosome brucei
• Promoter: proD
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TATTTCTAGATTTCAGTGCA
• 3′ sequencing primer: AAGATACTCTCAACCACGTAGAA

Gene/Insert 2

• Gene/Insert name: phosphatidylinositol 4-phosphate 5-kinase
• Alt name: phosphatidylinositol 4-phosphate 5-kinase type-1 α isoform 2
• Alt name: PI4P5Kα
• Alt name: PI4P5K
• Species: H. sapiens (human)
• Promoter: proD (in operon)
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCATGTATCATCTGGCGGTTCT
• 3′ sequencing primer: TTACAACAGTACTGCGATGA

Gene/Insert 3

• Gene/Insert name: phosphatidylinositol 4-kinase β
• Alt name: PI4K
• Alt name: phosphatidyl inositol 4-kinase β
• Alt name: PI4Kβ
• Species: Bos taurus
• Promoter: proD
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAAATGCCTCAAAATGTTCTTTACGAT
• 3′ sequencing primer: CTCGCCGCAGTCGAACGA

Resource Information

• Supplemental Documents:
  • p15aC-4D1D-5.gbk
• A portion of this plasmid was derived from a plasmid made by: Trypanosome brucei phosphatidyl inositol synthase (PIS)(30) was kindly provided by Dr. Terry K. Smith of The University of St Andrews, UK. Human phosphatidylinositol 4-phosphate 5-kinase type-1 α isoform 2 (PI4P5Kα, PI4P5K)(51) was kindly provided by Dr. Richard A. Anderson of the University of Wisconsin - Madison. Bos taurus phosphatidylinositol 4-kinase β (PI4Kβ, PI4K)(52) was kindly provided by Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH. See references in paper

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry