pLV(shRNA)-Puro-U6-CCEPR
(Plasmid #108277)

• Purpose: shRNA for CCEPR lncRNA
• Depositing Lab: Karl Munger
• Publication: Sharma et al Virology. 2018 Feb 7;518:8-13. doi: 10.1016/j.virol.2018.01.031.

Backbone

• Vector backbone: pLV-puro-U6
• Backbone size w/o insert (bp): 7520
• Total vector size (bp): 7567
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CCEPR
• gRNA/shRNA sequence: CCEPR
• Species: H. sapiens (human)
• Entrez Gene: CCEPR (a.k.a. CCHE1, lncRNA-CCHE1)
• Promoter: U6

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTC
• 3′ sequencing primer: CAAGGGTAGCGGCGAAGATC

Resource Information

• Supplemental Documents:
  • CCEPR1 shRNA complete data sheet
• A portion of this plasmid was derived from a plasmid made by: This vector was purchased from VectorBuilder.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry