Hy_pMT Flag-UAP56 MUT
(Plasmid
#110124)
-
PurposeExpresses Flag-tagged human UAP56 (DDX39B) with 4 mutations that impact circRNA nuclear export activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneHy_pMT
- Total vector size (bp) 8514
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUAP56
-
SpeciesH. sapiens (human)
-
Mutation4 mutations (KSLN motif changed to RSFS)
-
Entrez GeneDDX39B (a.k.a. BAT1, D6S81E, UAP56)
- Promoter Metallothionein Promoter (pMT)
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMT Flag-UAP56 MUT was a gift from Jeremy Wilusz (Addgene plasmid # 110124 ; http://n2t.net/addgene:110124 ; RRID:Addgene_110124) -
For your References section:
A length-dependent evolutionarily conserved pathway controls nuclear export of circular RNAs. Huang C, Liang D, Tatomer DC, Wilusz JE. Genes Dev. 2018 May 17. pii: gad.314856.118. doi: 10.1101/gad.314856.118. 10.1101/gad.314856.118 PubMed 29773557