Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMV-αIFNα-ab
(Plasmid #110799)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110799 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA/myc/ER
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4817
  • Total vector size (bp) 5066
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    antibody against mouse interferon alpha
  • Alt name
    αIFNα-ib
  • Alt name
    scFv derived from 4E-A1 monoclonal rat antibody
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    942
  • Promoter CMV
  • Tags / Fusion Proteins
    • myc epitope tag (C terminal on insert)
    • His6 tag (C terminal on insert)
    • ER signal peptide (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-αIFNα-ab was a gift from Thomas Böldicke (Addgene plasmid # 110799 ; http://n2t.net/addgene:110799 ; RRID:Addgene_110799)
  • For your References section:

    ER intrabody-mediated inhibition of interferon alpha secretion by mouse macrophages and dendritic cells. Bussow K, Themann P, Luu S, Pentrowski P, Harting C, Majewski M, Vollmer V, Koster M, Grashoff M, Zawatzky R, Van den Heuvel J, Kroger A, Boldicke T. PLoS One. 2019 Apr 16;14(4):e0215062. doi: 10.1371/journal.pone.0215062. eCollection 2019. 10.1371/journal.pone.0215062 PubMed 30990863