pNTK Gatad2a flox
(Plasmid #110812)

• Purpose: Donor targeting vector for generating mouse Gatad2a conditional knockout allele
• Depositing Lab: Jacob Hanna
• Publication: Mor et al Cell Stem Cell. 2018 Sep 6;23(3):412-425.e10. doi: 10.1016/j.stem.2018.07.004. Epub 2018 Aug 16.

Backbone

• Vector backbone: pNTK
• Total vector size (bp): 7828
• Vector type: Unspecified
• Selectable markers: Neomycin (select with G418) ; TK

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mGataD2a
• Alt name: p66a
• Species: M. musculus (mouse)
• Entrez Gene: Gatad2a (a.k.a. 1110066C11Rik)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: SmaI (unknown if destroyed)
• 5′ sequencing primer: gtgggttagggacggggtcc
• 3′ sequencing primer: gcgacacggaaatgttgaat

Resource Information

• Supplemental Documents:
  • pNTK GataD2a flox targeting construct.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry