-
Purpose(Empty Backbone) Donor empty vector with floxed puromycin resistance gene expression cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 68407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePL452
-
Backbone manufacturerFrederick National Lab
- Backbone size (bp) 4800
-
Modifications to backbonePL552 donor plasmid vector containing a floxed PGK-puromycin expression cassette was constructed by replacing the neomycin gene in the PL452 (Frederick National Lab) with a puromycin gene.
-
Vector typeMammalian Expression, Cre/Lox
- Promoter mouse PGK promoter
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer agctatgaccatgattacg
- 3′ sequencing primer aaacgacggccagtgaattg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PL552 was a gift from Su-Chun Zhang (Addgene plasmid # 68407 ; http://n2t.net/addgene:68407 ; RRID:Addgene_68407) -
For your References section:
Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478