Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68461)


Item Catalog # Description Quantity Price (USD)
Plasmid 68461 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8085
  • Total vector size (bp) 12382
  • Modifications to backbone
    amplified mammalian-codon-optimized Flpe recombinase cDNA and ERT2 cDNA by PCR from pDIRE (Addgene plasmid #26745) and pCAG-FlpeERT2 (Addgene plasmid #14756), respectively. The mammalian codon-optimized Flpe fused with ERT2 was inserted into the AAVS1-neo-CAG-hrGFP to replace GFP to get the AAVS1-neo-CAG-FlpeERT2 donor plasmid.
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    mammalian-codon-optimized Flpe recombinase fused with ERT2
  • Species
  • Insert Size (bp)
  • Promoter CAG
  • Tag / Fusion Protein
    • ERT2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer ggcttctggcgtgtgaccggc
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Blasticidin-CAG-Flpe-ERT2 was a gift from Su-Chun Zhang (Addgene plasmid # 68461 ; ; RRID:Addgene_68461)
  • For your References section:

    Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478