Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px330 Gatad2a sgRNA (for deletion)
(Plasmid #110814)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110814 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8520
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGataD2a
  • Alt name
    p66a
  • gRNA/shRNA sequence
    GAGCACAATCACATCAGGCG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Gatad2a (a.k.a. 1110066C11Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TGGCCTTTTGCTCACATGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330 Gatad2a sgRNA (for deletion) was a gift from Jacob Hanna (Addgene plasmid # 110814 ; http://n2t.net/addgene:110814 ; RRID:Addgene_110814)
  • For your References section:

    Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naive Pluripotency. Mor N, Rais Y, Sheban D, Peles S, Aguilera-Castrejon A, Zviran A, Elinger D, Viukov S, Geula S, Krupalnik V, Zerbib M, Chomsky E, Lasman L, Shani T, Bayerl J, Gafni O, Hanna S, Buenrostro JD, Hagai T, Masika H, Vainorius G, Bergman Y, Greenleaf WJ, Esteban MA, Elling U, Levin Y, Massarwa R, Merbl Y, Novershtern N, Hanna JH. Cell Stem Cell. 2018 Sep 6;23(3):412-425.e10. doi: 10.1016/j.stem.2018.07.004. Epub 2018 Aug 16. 10.1016/j.stem.2018.07.004 PubMed 30122475