-
PurposeImproved dCas9 repressor-dCas9-KRAB-MeCP2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 110821 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.3_TOPO
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-KRAB-MeCP2
-
Alt namedCas9-KM
-
SpeciesSynthetic
-
Insert Size (bp)5300
-
MutationCas9 mutations to make dCas9=D10A+D839A+H840A+N863A
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGTACTTCGACACCACCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110821 ; http://n2t.net/addgene:110821 ; RRID:Addgene_110821) -
For your References section:
An enhanced CRISPR repressor for targeted mammalian gene regulation. Yeo NC, Chavez A, Lance-Byrne A, Chan Y, Menn D, Milanova D, Kuo CC, Guo X, Sharma S, Tung A, Cecchi RJ, Tuttle M, Pradhan S, Lim ET, Davidsohn N, Ebrahimkhani MR, Collins JJ, Lewis NE, Kiani S, Church GM. Nat Methods. 2018 Jul 16. pii: 10.1038/s41592-018-0048-5. doi: 10.1038/s41592-018-0048-5. 10.1038/s41592-018-0048-5 PubMed 30013045