This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24th & 25th and December 31st & January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL
(Plasmid #111389)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111389 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4116
  • Total vector size (bp) 5769
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ChETA-mRuby2
  • Alt name
    hChR2(E123T/H134R)-mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    1653
  • GenBank ID
  • Promoter hSynapsin
  • Tag / Fusion Protein
    • mRuby2 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CCAAATTGCGCATCCCCTATC
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    W3SL
  • Species
    Synthetic
  • Insert Size (bp)
    427
  • Mutation
    W3SL is built from a shortened WPRE, an upstream element and SV40 late polyadenylation signal (Choi et al., 2014). This W3SL cassette allows 0.7 kb additional cloning capacity and shows comparable expression efficiency with conventional WPRE-polyA cassettes.

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PciI (not destroyed)
  • 5′ sequencing primer tgttgctccttttacgctatg
  • 3′ sequencing primer CCAGTTTGGAACAAGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Backbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968); W3SL cassette comes from plasmid pAAV-CW3SL-EGFP (Addgene, Plasmid #61463).
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL was a gift from Adam Kepecs (Addgene plasmid # 111389 ; http://n2t.net/addgene:111389 ; RRID:Addgene_111389)
  • For your References section:

    A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392