Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #112000)


Item Catalog # Description Quantity Price (USD)
Plasmid 112000 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 5989
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Promoter hSynapsin1
  • Tag / Fusion Protein
    • GAP43 palmitoylation domain (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GAAGGCGCGCTGACGTCACTCGCCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSynapsin1-axon-GCaMP6f was a gift from Lin Tian (Addgene plasmid # 112000 ; ; RRID:Addgene_112000)
  • For your References section:

    In vivo measurement of afferent activity with axon-specific calcium imaging. Broussard GJ, Liang Y, Fridman M, Unger EK, Meng G, Xiao X, Ji N, Petreanu L, Tian L. Nat Neurosci. 2018 Sep;21(9):1272-1280. doi: 10.1038/s41593-018-0211-4. Epub 2018 Aug 20. 10.1038/s41593-018-0211-4 PubMed 30127424