pEJS654 All-in-One AAV-sgRNA-hNmeCas9
(Plasmid #112139)

• Purpose: Delivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.
• Depositing Lab: Erik Sontheimer
• Publication: Ibraheim et al Genome Biol. 2018 Sep 19;19(1):137. doi: 10.1186/s13059-018-1515-0.

Backbone

• Vector backbone: PX551-Plasmid #60957
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 2880
• Total vector size (bp): 7278
• Vector type: Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA scaffold
• Insert Size (bp): 121
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ctctagaGTTTAAACAAA
• 3′ sequencing primer: GCATATACGATACAAGGCTGT

Gene/Insert 2

• Gene/Insert name: Human-codon-optimized NmeCas9
• Alt name: NmCas9
• Species: Neisseria meningitidis-strain 8013
• Insert Size (bp): 3243
• Promoter: U1a

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caaagtttttttcttccatt
• 3′ sequencing primer: gggcttcatgatgtcccc

Resource Information

• Supplemental Documents:
  • All-in-One AAV-sgRNA-hNmeCas9.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry