Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEJS654 All-in-One AAV-sgRNA-hNmeCas9
(Plasmid #112139)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112139 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX551-Plasmid #60957
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 2880
  • Total vector size (bp) 7278
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sgRNA scaffold
  • Insert Size (bp)
    121
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer ctctagaGTTTAAACAAA
  • 3′ sequencing primer GCATATACGATACAAGGCTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Human-codon-optimized NmeCas9
  • Alt name
    NmCas9
  • Species
    Neisseria meningitidis-strain 8013
  • Insert Size (bp)
    3243
  • Promoter U1a

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caaagtttttttcttccatt
  • 3′ sequencing primer gggcttcatgatgtcccc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS654 All-in-One AAV-sgRNA-hNmeCas9 was a gift from Erik Sontheimer (Addgene plasmid # 112139 ; http://n2t.net/addgene:112139 ; RRID:Addgene_112139)
  • For your References section:

    All-in-one adeno-associated virus delivery and genome editing by Neisseria meningitidis Cas9 in vivo. Ibraheim R, Song CQ, Mir A, Amrani N, Xue W, Sontheimer EJ. Genome Biol. 2018 Sep 19;19(1):137. doi: 10.1186/s13059-018-1515-0. 10.1186/s13059-018-1515-0 PubMed 30231914